WormMine: Gene WBGene00035167

• WormBase Gene ID: WBGene00035167
• Gene Name: Cbr-ctbp-1
• Sequence Name: CBG14767
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable NAD binding activity and oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor. Is an ortholog of C. elegans ctbp-1. In C. elegans, ctbp-1 is involved in negative regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14767a.1	CBG14767a.1		[unknown]
Transcript:CBG14767b.1	CBG14767b.1		[unknown]
Transcript:CBG14767c.1	CBG14767c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14767a	CBG14767a		[unknown]
CDS:CBG14767b	CBG14767b		[unknown]
CDS:CBG14767c	CBG14767c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057350
• Remark: Cbr-ctbp-1, TATTTCAGATTCGGAAAGCCATCAATGGCCGGTGTCCACAAGACCTAACACATTGTATTA, WBGene00035167
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region