WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035194 Gene Name  Cbr-lgx-1
Sequence Name  ? CBG14801 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds. Predicted to be involved in carbohydrate metabolic process. Is an ortholog of C. elegans lgx-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG14801d.1 CBG14801d.1   [unknown]
Transcript:CBG14801e.1 CBG14801e.1   [unknown]
Transcript:CBG14801b.1 CBG14801b.1   [unknown]
Transcript:CBG14801c.1 CBG14801c.1   [unknown]
Transcript:CBG14801a.1 CBG14801a.1   [unknown]
 

Other

5 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG14801a CBG14801a   [unknown]
CDS:CBG14801b CBG14801b   [unknown]
CDS:CBG14801c CBG14801c   [unknown]
CDS:CBG14801d CBG14801d   [unknown]
CDS:CBG14801e CBG14801e   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-lgx-1, TTAGAAAGTTGCGAGAGTGGAGAAGTTTGCGAAGGAGGATCTAGTTGTGATTATGACACT, WBGene00035194   Expr1060146 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG14800, AGCATGCGTGAAAAGTGTACCGGCGGAGCAATATGTGTGGAAGGAATGTGTCAATGCGAT, WBGene00035193   Expr1067969 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region