WormMine: Gene WBGene00035332

• WormBase Gene ID: WBGene00035332
• Gene Name: Cbr-fog-1
• Sequence Name: CBG14960
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable mRNA 3'-UTR binding activity and translation regulator activity. Predicted to be involved in regulation of translation. Is an ortholog of C. elegans fog-1. In C. elegans, fog-1 is involved in cell fate specification; germ-line sex determination; and spermatogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14960a.1	CBG14960a.1		[unknown]
Transcript:CBG14960b.1	CBG14960b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14960a	CBG14960a		[unknown]
CDS:CBG14960b	CBG14960b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051853
• Remark: Cbr-fog-1, GTGGGCTTTGGTTCAATCCATTTCTCGATGTTTACGATCAGTTGAAGAGTTGCAAATCAA, WBGene00035332
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region