WormMine: Gene WBGene00035376

• WormBase Gene ID: WBGene00035376
• Gene Name: Cbr-nstp-6
• Sequence Name: CBG15024
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable pyrimidine nucleotide-sugar transmembrane transporter activity. Predicted to be involved in pyrimidine nucleotide-sugar transmembrane transport. Predicted to be located in Golgi membrane. Is an ortholog of C. elegans nstp-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15024a.1	CBG15024a.1		[unknown]
Transcript:CBG15024b.1	CBG15024b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15024a	CBG15024a		[unknown]
CDS:CBG15024b	CBG15024b		[unknown]

0 RNAi Result

11 Allele

• WBVar00122036
• WBVar00122035
• WBVar00122037
• WBVar00122030
• WBVar00122032
• WBVar00122031
• WBVar00122034
• WBVar00122033
• WBVar00122027
• WBVar00122029
• WBVar00122028

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068277
• Remark: CBG15024, TTGGCTTGTCACAATTCTCAATTCCATCGGCGGTTTGTGTATTTCATTAGTGATGAAATA, WBGene00035376
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region