WormMine: Gene WBGene00035379

• WormBase Gene ID: WBGene00035379
• Gene Name: Cbr-unc-33
• Sequence Name: CBG15027
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds. Is an ortholog of C. elegans unc-33. In C. elegans, unc-33 is involved in several processes, including axon guidance; establishment or maintenance of cytoskeleton polarity; and regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15027.1	CBG15027.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15027	CBG15027		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069040
• Remark: Cbr-unc-33, AACTCCGGAGAATTCGACAGAAACCGAACAAAGGTCATGGAATCGTCCATTGATTTTGGA, WBGene00035379
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region