WormMine: Gene WBGene00035410

• WormBase Gene ID: WBGene00035410
• Gene Name: CBG15066
• Sequence Name: CBG15066
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in Golgi membrane. Is an ortholog of C. elegans Y11D7A.9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15066.1	CBG15066.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15066	CBG15066		[unknown]

0 RNAi Result

11 Allele

• WBVar00122100
• WBVar00122110
• WBVar00122102
• WBVar00122101
• WBVar00122104
• WBVar00122103
• WBVar00122106
• WBVar00122105
• WBVar00122108
• WBVar00122107
• WBVar00122109

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1061600
• Remark: CBG15066, CCTGAATATTTGTTTCCATGGATGTGCATTTTTCGATATTCGATATAAGGTTACGTTTAG, WBGene00035410
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region