WormMine: Gene WBGene00035467

• WormBase Gene ID: WBGene00035467
• Gene Name: Cbr-trp-2
• Sequence Name: CBG15139
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium channel activity. Predicted to be involved in calcium ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans trp-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15139.1	CBG15139.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15139	CBG15139		[unknown]

0 RNAi Result

15 Allele

• WBVar00040154
• WBVar00040159
• WBVar00040164
• WBVar00040124
• WBVar00040129
• WBVar00040134
• WBVar00040139
• WBVar00040144
• WBVar00040149
• WBVar00011874
• WBVar00011869
• WBVar00011864
• WBVar00011859
• WBVar00011854
• WBVar00122209

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063434
• Remark: Cbr-trp-2, CCATTTTTTGTCCGAATGGACGGGGAAAACGATATTTGGAAGTTATTGTTGTTGTTCAAT, WBGene00035467
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region