WormMine: Gene WBGene00035473

• WormBase Gene ID: WBGene00035473
• Gene Name: Cbr-dss-1
• Sequence Name: CBG15145
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in mRNA export from nucleus and proteasome assembly. Predicted to be part of proteasome regulatory particle, lid subcomplex. Is an ortholog of C. elegans dss-1. In C. elegans, dss-1 is involved in several processes, including intestinal absorption; positive regulation of protein ubiquitination; and vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15145.1	CBG15145.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15145	CBG15145		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063127
• Remark: Cbr-dss-1, AGACCCACGAGAGCGAATTCTCGAAGCAGCTAAAGGAGGAACTTCGCAAAGGAGGACATC, WBGene00035473
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region