WormMine: Gene WBGene00035480

• WormBase Gene ID: WBGene00035480
• Gene Name: Cbr-uaf-1
• Sequence Name: CBG15152
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Predicted to be involved in mRNA processing. Predicted to be located in nucleus. Is an ortholog of C. elegans uaf-1. In C. elegans, uaf-1 is involved in several processes, including embryonic body morphogenesis; mRNA 3'-splice site recognition; and nematode larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15152a.1	CBG15152a.1		[unknown]
Transcript:CBG15152b.1	CBG15152b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15152a	CBG15152a		[unknown]
CDS:CBG15152b	CBG15152b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057629
• Remark: Cbr-uaf-1, GAGAAGTGACGAGGATTATGAGGAGATTCTCGAAGACGTTCGTGAGGAGTGCTCCAAGTA, WBGene00035480
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region