WormMine: Gene WBGene00035496

• WormBase Gene ID: WBGene00035496
• Gene Name: Cbr-crls-1
• Sequence Name: CBG15172
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity. Predicted to be involved in phospholipid biosynthetic process. Predicted to be located in membrane. Is an ortholog of C. elegans crls-1. In C. elegans, crls-1 is involved in cardiolipin biosynthetic process; regulation of cell population proliferation; and regulation of mitochondrial membrane potential.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15172.1	CBG15172.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15172	CBG15172		[unknown]

0 RNAi Result

4 Allele

• WBVar00011899
• WBVar00122225
• WBVar00122224
• WBVar00122226

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067754
• Remark: Cbr-crls-1, AATCGATTCTTCAATCCACAAGTTTCTTCGATGCAAGTCGTTCCTACTATGATGAGCAAG, WBGene00035496
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region