WormMine: Gene WBGene00035554

• WormBase Gene ID: WBGene00035554
• Gene Name: Cbr-ptl-1
• Sequence Name: CBG15240
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable tubulin binding activity. Is an ortholog of C. elegans ptl-1. In C. elegans, ptl-1 is involved in microtubule polymerization and positive regulation of nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15240a.1	CBG15240a.1		[unknown]
Transcript:CBG15240c.1	CBG15240c.1		[unknown]
Transcript:CBG15240b.1	CBG15240b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15240a	CBG15240a		[unknown]
CDS:CBG15240b	CBG15240b		[unknown]
CDS:CBG15240c	CBG15240c		[unknown]

0 RNAi Result

12 Allele

• WBVar00122261
• WBVar00122260
• WBVar00122263
• WBVar00122262
• WBVar00122264
• WBVar00122256
• WBVar00122255
• WBVar00122258
• WBVar00122257
• WBVar00122259
• WBVar00122254
• WBVar00122253

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053725
• Remark: Cbr-ptl-1, TGGAAAGCGGAGAGTAAAGTGGGATCCAAGGATAATATGAATCATCGACCAGGAGGTGGA, WBGene00035554
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region