WormMine: Gene WBGene00035603

• WormBase Gene ID: WBGene00035603
• Gene Name: Cbr-hmgr-1
• Sequence Name: CBG15296
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable hydroxymethylglutaryl-CoA reductase (NADPH) activity. Predicted to be involved in coenzyme A metabolic process and isoprenoid biosynthetic process. Is an ortholog of C. elegans hmgr-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15296.1	CBG15296.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15296	CBG15296		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058398
• Remark: CBG15296, CTCGTTGATGGCTGCATTGACAACAAATGACCTGGTTTCGAGTCATATGAAGTTGAATAG, WBGene00035603
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region