WormMine: Gene WBGene00035743

• WormBase Gene ID: WBGene00035743
• Gene Name: Cbr-cyp-29A3
• Sequence Name: CBG15509
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable heme binding activity; iron ion binding activity; and oxidoreductase activity. Is an ortholog of C. elegans cyp-29A3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15509.1	CBG15509.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15509	CBG15509		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1066174
• Remark: Cbr-cyp-29A3, TCCTTTCTCTGCCGGCCTTCGTAACTGCATTGGACAGAAATTCGCGCAAATGAATGAAAA, WBGene00035743
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region