WormMine: Gene WBGene00035804

• WormBase Gene ID: WBGene00035804
• Gene Name: Cbr-npr-22
• Sequence Name: CBG15641
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans npr-22. In C. elegans, npr-22 is involved in several processes, including determination of adult lifespan; negative regulation of feeding behavior; and positive regulation of egg-laying behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15641.1	CBG15641.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15641	CBG15641		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062522
• Remark: CBG15641, CGTTTCCGAGAGGGATTCTGTTATTTCTCATCAAAATTATTGCCATGTGTCGTTTTCAAA, WBGene00035804
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region