WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035822 Gene Name  CBG15664
Sequence Name  ? CBG15664 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Dual specificity protein phosphatase domain; Protein-tyrosine phosphatase-like; and Dual specificity phosphatase, catalytic domain. Is an ortholog of C. elegans Y54F10BM.13. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG15664.2 CBG15664.2   [unknown]
Transcript:CBG15664.1 CBG15664.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG15664 CBG15664   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG15664, TGCAATGCTGGAATTTCACGATCCGCCTCGTTTGCAGTTGGTTATTTGATGAAAACACAA, WBGene00035822   Expr1050816 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG15665, GTGCTTGGAGGGAGAGTGCAATGCGTTCTTGTATGAATCCGGTACAGTAAACAAGAGTTT, WBGene00035823   Expr1069511 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region