WormMine: Gene WBGene00035851

• WormBase Gene ID: WBGene00035851
• Gene Name: Cbr-pll-1
• Sequence Name: CBG15703
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable phosphatidylinositol phospholipase C activity. Predicted to be involved in intracellular signal transduction and lipid metabolic process. Is an ortholog of C. elegans pll-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15703b.1	CBG15703b.1		[unknown]
Transcript:CBG15703a.1	CBG15703a.1		[unknown]
Transcript:CBG15703c.1	CBG15703c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15703b	CBG15703b		[unknown]
CDS:CBG15703c	CBG15703c		[unknown]
CDS:CBG15703a	CBG15703a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068850
• Remark: Cbr-pll-1, TGAAAGCGCAGCTCAATTTAATGAATAAGTCCCAAGAGGAGGCACAGGATGTTGTTACTC, WBGene00035851
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region