WormMine: Gene WBGene00035885

• WormBase Gene ID: WBGene00035885
• Gene Name: Cbr-gab-1
• Sequence Name: CBG15740
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GABA-A receptor activity and extracellular ligand-gated monoatomic ion channel activity. Predicted to be involved in monoatomic ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans gab-1. In C. elegans, gab-1 is involved in monoatomic ion transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15740.1	CBG15740.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15740	CBG15740		[unknown]

0 RNAi Result

7 Allele

• WBVar00003024
• WBVar00003029
• WBVar00123010
• WBVar00123006
• WBVar00123008
• WBVar00123007
• WBVar00123009

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055364
• Remark: Cbr-gab-1, GCTAGGAAAGTAATCCCTTCGATTCGTGTCCGAGATGTCAACCTTATCGATAAATACTCA, WBGene00035885
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region