WormMine: Gene WBGene00035959

• WormBase Gene ID: WBGene00035959
• Gene Name: Cbr-ksr-2
• Sequence Name: CBG15834
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein tyrosine kinase activity. Is an ortholog of C. elegans ksr-2. In C. elegans, ksr-2 is involved in several processes, including Ras protein signal transduction; nematode male tail tip morphogenesis; and positive regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15834c.1	CBG15834c.1		[unknown]
Transcript:CBG15834a.1	CBG15834a.1		[unknown]
Transcript:CBG15834b.1	CBG15834b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15834c	CBG15834c		[unknown]
CDS:CBG15834a	CBG15834a		[unknown]
CDS:CBG15834b	CBG15834b		[unknown]

0 RNAi Result

9 Allele

• WBVar00019552
• WBVar00019547
• WBVar00123280
• WBVar00123282
• WBVar00123281
• WBVar00123284
• WBVar00123283
• WBVar00123285
• WBVar00123279

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050960
• Remark: Cbr-ksr-2, GGCCCACTTTTGCGTATATTGTCAAACGGATCACCTCAATGATGCCCCGGAATAAGGAAT, WBGene00035959
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region