WormMine: Gene WBGene00036076

• WormBase Gene ID: WBGene00036076
• Gene Name: Cbr-mrp-3
• Sequence Name: CBG15993
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ABC-type transporter activity; ATP binding activity; and ATP hydrolysis activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans mrp-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15993.1	CBG15993.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15993	CBG15993		[unknown]

0 RNAi Result

17 Allele

• WBVar00056949
• WBVar00056944
• WBVar00056934
• WBVar00056939
• WBVar00056954
• WBVar00123547
• WBVar00123548
• WBVar00025564
• WBVar00025534
• WBVar00025539
• WBVar00025544
• WBVar00025549
• WBVar00025519
• WBVar00025554
• WBVar00025524
• WBVar00025559
• WBVar00025529

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058612
• Remark: Cbr-mrp-3, TCCCGTTTATATAATCTACTATTTTGTGCTCAAGTACTCCATTAAGAGTACCCGTCAACT, WBGene00036076
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region