WormMine: Gene WBGene00036088

• WormBase Gene ID: WBGene00036088
• Gene Name: Cbr-acl-1
• Sequence Name: CBG16005
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable 1-acylglycerol-3-phosphate O-acyltransferase activity. Predicted to be involved in phospholipid biosynthetic process. Predicted to be located in membrane. Is an ortholog of C. elegans acl-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16005a.1	CBG16005a.1		[unknown]
Transcript:CBG16005b.1	CBG16005b.1		[unknown]
Transcript:CBG16005b.2	CBG16005b.2		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16005a	CBG16005a		[unknown]
CDS:CBG16005b	CBG16005b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064932
• Remark: Cbr-acl-1, TGCCGTAACATCATGCAGCAGCATCGCTACAAACTCGACGCGGAAGCTGCCAATCTCAAT, WBGene00036088
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region