WormMine: Gene WBGene00036113

• WormBase Gene ID: WBGene00036113
• Gene Name: CBG16040
• Sequence Name: CBG16040
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans hpk-1. In C. elegans, hpk-1 is involved in autophagosome assembly; determination of adult lifespan; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16040a.1	CBG16040a.1		[unknown]
Transcript:CBG16040b.1	CBG16040b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16040b	CBG16040b		[unknown]
CDS:CBG16040a	CBG16040a		[unknown]

0 RNAi Result

6 Allele

• WBVar00047707
• WBVar00047702
• WBVar00047717
• WBVar00047712
• WBVar00047722
• WBVar00047697

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058318
• Remark: CBG16040, CAAAATGAGTCATTTGACGACTCAGGGGTTCTCGAACTACCTCCATGAGGCCAACAAGCG, WBGene00036113
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region