WormMine: Gene WBGene00036142

• WormBase Gene ID: WBGene00036142
• Gene Name: Cbr-del-8
• Sequence Name: CBG16079
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable sodium channel activity. Predicted to be involved in sodium ion transport. Predicted to be located in membrane. Is an ortholog of C. elegans del-8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16079b.1	CBG16079b.1		[unknown]
Transcript:CBG16079a.1	CBG16079a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16079b	CBG16079b		[unknown]
CDS:CBG16079a	CBG16079a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063560
• Remark: Cbr-tag-263, ACATCTATCCGCCAGAAAAATCAATCTCCAAGGAGCACATTGCAACTCTGAGCCGTCGAG, WBGene00036142
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region