WormMine: Gene WBGene00036211

• WormBase Gene ID: WBGene00036211
• Gene Name: Cbr-vav-1
• Sequence Name: CBG16186
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable guanyl-nucleotide exchange factor activity. Is an ortholog of C. elegans vav-1. In C. elegans, vav-1 is involved in several processes, including negative regulation of Notch signaling pathway; positive regulation of nematode male tail tip morphogenesis; and regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16186c.1	CBG16186c.1		[unknown]
Transcript:CBG16186d.1	CBG16186d.1		[unknown]
Transcript:CBG16186a.1	CBG16186a.1		[unknown]
Transcript:CBG16186b.1	CBG16186b.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16186c	CBG16186c		[unknown]
CDS:CBG16186b	CBG16186b		[unknown]
CDS:CBG16186d	CBG16186d		[unknown]
CDS:CBG16186a	CBG16186a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052512
• Remark: Cbr-vav-1, TGACGGAAAGTTTCTCACATTTAAAATGGGCGATATCATAGTATTACTGGATACGGTGGG, WBGene00036211
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region