WormMine: Gene WBGene00036253

• WormBase Gene ID: WBGene00036253
• Gene Name: Cbr-aak-2
• Sequence Name: CBG16249
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans aak-2. In C. elegans, aak-2 is involved in several processes, including determination of adult lifespan; nematode pharyngeal pumping; and regulation of protein secretion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16249a.1	CBG16249a.1		[unknown]
Transcript:CBG16249b.1	CBG16249b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16249b	CBG16249b		[unknown]
CDS:CBG16249a	CBG16249a		[unknown]

0 RNAi Result

6 Allele

• WBVar00055564
• WBVar00123695
• WBVar00023994
• WBVar00023979
• WBVar00023984
• WBVar00023989

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065195
• Remark: Cbr-aak-2, CAAAGATGTCACTTCAACTCTACCAAGTTGACCAGAGGAGCTATCTTCTCGATTTCAAGA, WBGene00036253
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region