WormMine: Gene WBGene00036256

• WormBase Gene ID: WBGene00036256
• Gene Name: Cbr-sto-5
• Sequence Name: CBG16252
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in plasma membrane. Is an ortholog of C. elegans sto-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16252c.1	CBG16252c.1		[unknown]
Transcript:CBG16252a.1	CBG16252a.1		[unknown]
Transcript:CBG16252b.1	CBG16252b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16252b	CBG16252b		[unknown]
CDS:CBG16252c	CBG16252c		[unknown]
CDS:CBG16252a	CBG16252a		[unknown]

0 RNAi Result

2 Allele

• WBVar00020797
• WBVar00020802

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051903
• Remark: Cbr-sto-5, ATAACAGAAAAGGTGCTCGACGAAGGAACCGATCCATGGGGTGTGAAAGTGGAGCGTGTC, WBGene00036256
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region