WormMine: Gene WBGene00036290

• WormBase Gene ID: WBGene00036290
• Gene Name: Cbr-ceh-37
• Sequence Name: CBG16312
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity. Is an ortholog of C. elegans ceh-37. In C. elegans, ceh-37 is involved in neuron fate specification; olfactory behavior; and regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16312b.1	CBG16312b.1		[unknown]
Transcript:CBG16312c.1	CBG16312c.1		[unknown]
Transcript:CBG16312a.1	CBG16312a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16312a	CBG16312a		[unknown]
CDS:CBG16312b	CBG16312b		[unknown]
CDS:CBG16312c	CBG16312c		[unknown]

0 RNAi Result

1 Allele

• WBVar00021062

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058899
• Remark: Cbr-ceh-37, CAATTCGGTCAGGCGCCATATTCGGGAACCCCGTTTTGGCACCATAACCAGTCTTTGTAA, WBGene00036290
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region