Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG16316.1 | CBG16316.1 | [unknown] |
Other
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Virus infection: Santeuil infected at L3 larva stage for 12 hours. | Transcripts that showed signicantly decreased expression after Santeuil virus infection to C. briggsae strain JU1264. | edgeR, FDR < 0.05. | WBPaper00051137:Santeuil-virus_downregulated_JU1264 |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG16316, TGGATTTTTTGGCTATGAAAGACAAACAATGGATGAGGACAACATCGATCCACTTGGTTC, WBGene00036291 | Expr1050599 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |