WormMine: Gene WBGene00036330

• WormBase Gene ID: WBGene00036330
• Gene Name: Cbr-ace-1
• Sequence Name: CBG16374
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable cholinesterase activity. Is an ortholog of C. elegans ace-1. In C. elegans, ace-1 is involved in acetylcholine catabolic process and regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16374.1	CBG16374.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16374	CBG16374		[unknown]

0 RNAi Result

1 Allele

• WBVar00021162

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063023
• Remark: Cbr-ace-1, CAGGCCAAAACCGGATAGGGCACGGTCCGCGGAGAAAAGAATGCGCATTCTGGAAAGCAT, WBGene00036330
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region