WormMine: Gene WBGene00036333

• WormBase Gene ID: WBGene00036333
• Gene Name: Cbr-taf-3
• Sequence Name: CBG16377
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein heterodimerization activity. Is an ortholog of C. elegans taf-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16377b.2	CBG16377b.2		[unknown]
Transcript:CBG16377b.1	CBG16377b.1		[unknown]
Transcript:CBG16377a.1	CBG16377a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16377a	CBG16377a		[unknown]
CDS:CBG16377b	CBG16377b		[unknown]

0 RNAi Result

1 Allele

• WBVar00024899

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054920
• Remark: Cbr-taf-3, GACAACAGGCACACCAGTCAAGGTGAAACTGGCAGTGGGACGTCCGAAGAAGCCAAAGCC, WBGene00036333
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region