WormMine: Gene WBGene00036378

• WormBase Gene ID: WBGene00036378
• Gene Name: Cbr-parg-2
• Sequence Name: CBG16441
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable poly(ADP-ribose) glycohydrolase activity. Predicted to be involved in carbohydrate metabolic process and regulation of DNA repair. Is an ortholog of C. elegans parg-2. In C. elegans, parg-2 is involved in nucleotide-sugar metabolic process and response to gamma radiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16441.1	CBG16441.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16441	CBG16441		[unknown]

0 RNAi Result

26 Allele

• WBVar00123909
• WBVar00123921
• WBVar00123920
• WBVar00123923
• WBVar00123922
• WBVar00123924
• WBVar00123910
• WBVar00123912
• WBVar00123911
• WBVar00123914
• WBVar00123913
• WBVar00123916
• WBVar00123915
• WBVar00123918
• WBVar00123917
• WBVar00123919
• WBVar00021307
• WBVar00021312
• WBVar00021317
• WBVar00021322
• WBVar00021327
• WBVar00021332
• WBVar00021337
• WBVar00021292
• WBVar00021297
• WBVar00021302

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063480
• Remark: Cbr-pme-3, AAGAAATCCGTTTCCTAATGTGTCCCGAAATGATTGTCGGAATGTTGCTGACGGACAAAA, WBGene00036378
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region