WormMine: Gene WBGene00036421

• WormBase Gene ID: WBGene00036421
• Gene Name: Cbr-rfl-1
• Sequence Name: CBG16503
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable NEDD8 activating enzyme activity. Predicted to be involved in protein neddylation. Is an ortholog of C. elegans rfl-1. In C. elegans, rfl-1 is involved in negative regulation of DNA damage response, signal transduction by p53 class mediator and protein neddylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16503.1	CBG16503.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16503	CBG16503		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068941
• Remark: Cbr-rfl-1, CAATCGACAACTATCTCAACTTTACTCAAATCCACGGCGCATACACCAGTGTTGTTTCTA, WBGene00036421
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region