WormMine: Gene WBGene00036422

• WormBase Gene ID: WBGene00036422
• Gene Name: Cbr-cyk-1
• Sequence Name: CBG16504
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable actin binding activity and small GTPase binding activity. Predicted to be involved in actin cytoskeleton organization. Is an ortholog of C. elegans cyk-1. In C. elegans, cyk-1 is involved in pronuclear migration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16504a.1	CBG16504a.1		[unknown]
Transcript:CBG16504b.1	CBG16504b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16504b	CBG16504b		[unknown]
CDS:CBG16504a	CBG16504a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1068201
• Remark: Cbr-cyk-1, TTCGGAGTTGGATTGCCTATTGGGCAGAATGAGCTGAAAATTCGAGTGAGAAGGAAAGGA, WBGene00036422
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region