WormMine: Gene WBGene00029166

• WormBase Gene ID: WBGene00029166
• Gene Name: Cbr-luc-7L3
• Sequence Name: CBG06988
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable mRNA binding activity. Predicted to be involved in mRNA splice site recognition. Predicted to be part of U1 snRNP. Is an ortholog of C. elegans luc-7L3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06988.1	CBG06988.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06988	CBG06988		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063459
• Remark: CBG06988, CGTCTTCTCCGCTTTCTAGTTCACTTGGATGAAGATAATCTGAGAAGAATCCGAAAGAAT, WBGene00029166
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region