WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00036438 Gene Name  Cbr-wip-1
Sequence Name  ? CBG16525 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable actin binding activity. Is an ortholog of C. elegans wip-1. In C. elegans, wip-1 is involved in embryonic body morphogenesis; regulation of cell migration; and regulation of protein stability. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG16525a.1 CBG16525a.1   [unknown]
Transcript:CBG16525b.1 CBG16525b.1   [unknown]
Transcript:CBG16525c.1 CBG16525c.1   [unknown]
Transcript:CBG16525d.1 CBG16525d.1   [unknown]
Transcript:CBG16525e.1 CBG16525e.1   [unknown]
Transcript:CBG16525f.1 CBG16525f.1   [unknown]
 

Other

6 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG16525f CBG16525f   [unknown]
CDS:CBG16525e CBG16525e   [unknown]
CDS:CBG16525d CBG16525d   [unknown]
CDS:CBG16525c CBG16525c   [unknown]
CDS:CBG16525b CBG16525b   [unknown]
CDS:CBG16525a CBG16525a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-wip-1, CACAAGCGAGTTCTCCGTATCCTGGAATGATGTCTACGGCAACAGTTTCTGCGAATGTGC, WBGene00036438   Expr1070056 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region