WormMine: Gene WBGene00036577

• WormBase Gene ID: WBGene00036577
• Gene Name: Cbr-uggt-1
• Sequence Name: CBG16703
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable UDP-glucose:glycoprotein glucosyltransferase activity. Predicted to be involved in protein glycosylation. Is an ortholog of C. elegans uggt-1. In C. elegans, uggt-1 is involved in IRE1-mediated unfolded protein response; protein N-linked glycosylation via asparagine; and regulation of nematode larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16703.1	CBG16703.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16703	CBG16703		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064338
• Remark: CBG16703, GAGAGCAGAAAGGAGATGGATGGATTCCGGTTCTGGAAGCAAGGATACTGGGCGAATCAT, WBGene00036577
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region