WormMine: Gene WBGene00036592

• WormBase Gene ID: WBGene00036592
• Gene Name: CBG16727
• Sequence Name: CBG16727
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable monoatomic cation transmembrane transporter activity. Predicted to be involved in monoatomic cation transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans PDB1.1. In C. elegans, PDB1.1 is involved in innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16727.1	CBG16727.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16727	CBG16727		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Virus infection: Santeuil infected at L3 larva stage for 12 hours.	Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264.	edgeR, FDR < 0.05.	WBPaper00051137:Santeuil-virus_upregulated_JU1264

1 Expression Patterns

• Primary Identifier: Expr1062650
• Remark: CBG16727, GAGAGTTTACAAGTGAAGCTGGAGAAGTTGCCGTATGTGGAGCGTGCTTTTGTACATTGT, WBGene00036592
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region