WormMine: Gene WBGene00036639

• WormBase Gene ID: WBGene00036639
• Gene Name: Cbr-sek-1
• Sequence Name: CBG16802
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans sek-1. In C. elegans, sek-1 is involved in several processes, including defense response to other organism; p38MAPK cascade; and positive regulation of macromolecule biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16802.1	CBG16802.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16802	CBG16802		[unknown]

0 RNAi Result

6 Allele

• WBVar00018144
• WBVar00018134
• WBVar00018139
• WBVar00018129
• WBVar00018124
• WBVar00018119

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063566
• Remark: Cbr-sek-1, TATCCAGAGCTCCTAGCTATGCCGTTCATGGAGATGGCTAGAAACGAGAAACAATTCAGC, WBGene00036639
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region