WormMine: Gene WBGene00036678

• WormBase Gene ID: WBGene00036678
• Gene Name: Cbr-tnt-3
• Sequence Name: CBG16852
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in regulation of muscle contraction. Predicted to be part of troponin complex. Is an ortholog of C. elegans tnt-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16852a.1	CBG16852a.1		[unknown]
Transcript:CBG16852c.1	CBG16852c.1		[unknown]
Transcript:CBG16852b.1	CBG16852b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16852a	CBG16852a		[unknown]
CDS:CBG16852c	CBG16852c		[unknown]
CDS:CBG16852b	CBG16852b		[unknown]

0 RNAi Result

8 Allele

• WBVar00044499
• WBVar00124347
• WBVar00124348
• WBVar00124345
• WBVar00124346
• WBVar00124349
• WBVar00124343
• WBVar00124344

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057936
• Remark: Cbr-tnt-3, AAGAGCTCAACGAGCGTCAACGTCAAGTAACCCGCAACTCCGCTCTCAAGAAGGGCATTG, WBGene00036678
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region