WormMine: Gene WBGene00036711

• WormBase Gene ID: WBGene00036711
• Gene Name: Cbr-npr-10
• Sequence Name: CBG16910
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable neuropeptide Y receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans npr-10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16910a.1	CBG16910a.1		[unknown]
Transcript:CBG16910c.1	CBG16910c.1		[unknown]
Transcript:CBG16910b.1	CBG16910b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16910c	CBG16910c		[unknown]
CDS:CBG16910b	CBG16910b		[unknown]
CDS:CBG16910a	CBG16910a		[unknown]

0 RNAi Result

5 Allele

• WBVar00044604
• WBVar00044599
• WBVar00044594
• WBVar00124376
• WBVar00124375

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056451
• Remark: Cbr-npr-10, AGGATTTATTGCTGATCAGGATTATCTCTTCGGAATTATCTCTCACTGTATCTCTATGGC, WBGene00036711
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region