WormMine: Gene WBGene00036728

• WormBase Gene ID: WBGene00036728
• Gene Name: Cbr-tat-5
• Sequence Name: CBG16933
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP hydrolysis activity; ATPase-coupled intramembrane lipid transporter activity; and small molecule binding activity. Predicted to be involved in phospholipid transport. Predicted to be located in membrane. Is an ortholog of C. elegans tat-5. In C. elegans, tat-5 is involved in embryo development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16933b.1	CBG16933b.1		[unknown]
Transcript:CBG16933a.1	CBG16933a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16933a	CBG16933a		[unknown]
CDS:CBG16933b	CBG16933b		[unknown]

0 RNAi Result

25 Allele

• WBVar00001809
• WBVar00001804
• WBVar00001819
• WBVar00001814
• WBVar00001749
• WBVar00001744
• WBVar00001759
• WBVar00001754
• WBVar00001739
• WBVar00001789
• WBVar00001784
• WBVar00001799
• WBVar00001794
• WBVar00001769
• WBVar00001764
• WBVar00001779
• WBVar00001774
• WBVar00124400
• WBVar00124401
• WBVar00124399
• WBVar00028744
• WBVar00028749
• WBVar00028754
• WBVar00028759
• WBVar00028764

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062945
• Remark: Cbr-tat-5, TTCATTCATGTCGTTTCGATTTCGTTCTCGGCGCTGATTGTTACCGAATTGATTATGGTT, WBGene00036728
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region