WormMine: Gene WBGene00036856

• WormBase Gene ID: WBGene00036856
• Gene Name: Cbr-dkf-2
• Sequence Name: CBG17105
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein serine/threonine kinase activity. Is an ortholog of C. elegans dkf-2. In C. elegans, dkf-2 is involved in defense response to bacterium; determination of adult lifespan; and signal transduction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17105d.1	CBG17105d.1		[unknown]
Transcript:CBG17105c.1	CBG17105c.1		[unknown]
Transcript:CBG17105b.1	CBG17105b.1		[unknown]
Transcript:CBG17105a.1	CBG17105a.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17105d	CBG17105d		[unknown]
CDS:CBG17105c	CBG17105c		[unknown]
CDS:CBG17105b	CBG17105b		[unknown]
CDS:CBG17105a	CBG17105a		[unknown]

0 RNAi Result

72 Allele

• WBVar00138433
• WBVar00138432
• WBVar00138435
• WBVar00138434
• WBVar00138436
• WBVar00041049
• WBVar00041044
• WBVar00041054
• WBVar00047287
• WBVar00047292
• WBVar00012704
• WBVar00012609
• WBVar00012604
• WBVar00012699
• WBVar00012649
• WBVar00012644
• WBVar00012639
• WBVar00012634
• WBVar00012629
• WBVar00012624
• WBVar00012619
• WBVar00012614
• WBVar00012689
• WBVar00012684
• WBVar00012694
• WBVar00012679
• WBVar00012674
• WBVar00012669
• WBVar00012664
• WBVar00012659

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059568
• Remark: Cbr-dkf-2, CACTCACGAATCGGATGATTCCAGATGGCATGCCTATGAAAAAGAACACAACGTCACACC, WBGene00036856
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region