WormMine: Gene WBGene00036887

• WormBase Gene ID: WBGene00036887
• Gene Name: Cbr-rnp-9
• Sequence Name: CBG17168
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Is an ortholog of C. elegans rnp-9. In C. elegans, rnp-9 is involved in determination of adult lifespan; hyperosmotic response; and response to heat.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17168.1	CBG17168.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17168	CBG17168		[unknown]

0 RNAi Result

2 Allele

• WBVar00022477
• WBVar00022472

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053548
• Remark: CBG17168, GAGATGAACGGGAAAGAGTTGGCTGGGAATCAAGTCAGATGCTCTTGGGGAAGAACACAG, WBGene00036887
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region