WormMine: Gene WBGene00036928

• WormBase Gene ID: WBGene00036928
• Gene Name: Cbr-pkn-1
• Sequence Name: CBG17230
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein serine/threonine kinase activity. Predicted to be involved in signal transduction. Is an ortholog of C. elegans pkn-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17230b.1	CBG17230b.1		[unknown]
Transcript:CBG17230c.1	CBG17230c.1		[unknown]
Transcript:CBG17230d.1	CBG17230d.1		[unknown]
Transcript:CBG17230a.1	CBG17230a.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17230a	CBG17230a		[unknown]
CDS:CBG17230b	CBG17230b		[unknown]
CDS:CBG17230c	CBG17230c		[unknown]
CDS:CBG17230d	CBG17230d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068073
• Remark: Cbr-pkn-1, GAAAAGCGTCTCGGCTATGGAGAACGTGATGCTGAGGACATCAAAATCCAGCGCTTCTTC, WBGene00036928
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region