WormMine: Gene WBGene00036935

• WormBase Gene ID: WBGene00036935
• Gene Name: Cbr-mig-15
• Sequence Name: CBG17239
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans mig-15. In C. elegans, mig-15 is involved in several processes, including dorsal/ventral axon guidance; nematode larval development; and regulation of GABAergic synaptic transmission.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17239a.1	CBG17239a.1		[unknown]
Transcript:CBG17239b.1	CBG17239b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17239b	CBG17239b		[unknown]
CDS:CBG17239a	CBG17239a		[unknown]

0 RNAi Result

15 Allele

• cbp40242
• cbp40243
• cbp40241
• WBVar00015414
• WBVar00124934
• WBVar00124935
• WBVar00124933
• WBVar00124938
• WBVar00124939
• WBVar00124936
• WBVar00124937
• WBVar00124941
• WBVar00124942
• WBVar00124940
• WBVar00124943

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053892
• Remark: Cbr-mig-15, CTGCAAAAGGTGGCGGCTCTTGCCAAATCTATTTCATGACTCTGAACAAACCAGGACTCA, WBGene00036935
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region