WormMine: Gene WBGene00036972

• WormBase Gene ID: WBGene00036972
• Gene Name: Cbr-mig-2
• Sequence Name: CBG17302
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GTP binding activity and GTPase activity. Is an ortholog of C. elegans mig-2. In C. elegans, mig-2 is involved in several processes, including actin cytoskeleton organization; axon guidance; and cell migration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17302.1	CBG17302.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17302	CBG17302		[unknown]

0 RNAi Result

12 Allele

• WBVar00022922
• WBVar00022907
• WBVar00022892
• WBVar00022927
• WBVar00022912
• WBVar00022897
• WBVar00022882
• WBVar00022932
• WBVar00022917
• WBVar00022902
• WBVar00022887
• WBVar00022937

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064806
• Remark: Cbr-mig-2, CGGTTCGCTCAATTCTCCATCCGAAACCACAGAAAAAGAAGAAGTCTTGCACCCTCATGT, WBGene00036972
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region