WormMine: Gene WBGene00037006

• WormBase Gene ID: WBGene00037006
• Gene Name: Cbr-pgp-3
• Sequence Name: CBG17357
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ABC-type transporter activity; ATP binding activity; and ATP hydrolysis activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Expressed in excretory canal and intestine. Is an ortholog of C. elegans pgp-3. In C. elegans, pgp-3 is involved in defense response to Gram-negative bacterium; innate immune response; and stress response to cadmium ion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17357.1	CBG17357.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17357	CBG17357		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

• Primary Identifier: Expr4624
• Remark: Species: C. briggsae.
• Pattern: In C. briggsae, the gene expressed in: excretory cell and intestine.

• Primary Identifier: Expr1056043
• Remark: Cbr-pgp-3, ACAAAGCTCGCCTTGGAAGAACCTGTATTGTGATTGCTCATCGCTTATCGACTATTCAAA, WBGene00037006
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr4623
• Pattern: Expressed in: excretory cell and intestine.

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region