WormMine: Gene WBGene00037041

• WormBase Gene ID: WBGene00037041
• Gene Name: CBG17404
• Sequence Name: CBG17404
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable serine-type endopeptidase inhibitor activity. Is an ortholog of C. elegans C34F6.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17404a.1	CBG17404a.1		[unknown]
Transcript:CBG17404b.1	CBG17404b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17404b	CBG17404b		[unknown]
CDS:CBG17404a	CBG17404a		[unknown]

0 RNAi Result

33 Allele

• WBVar00041444
• WBVar00041404
• WBVar00041409
• WBVar00041414
• WBVar00041419
• WBVar00041424
• WBVar00041429
• WBVar00041439
• WBVar00041434
• WBVar00041369
• WBVar00041364
• WBVar00041374
• WBVar00041379
• WBVar00041384
• WBVar00041389
• WBVar00041394
• WBVar00041399
• WBVar00041359
• WBVar00041354
• WBVar00012929
• WBVar00012924
• WBVar00012919
• WBVar00012964
• WBVar00012959
• WBVar00012954
• WBVar00012949
• WBVar00012944
• WBVar00012939
• WBVar00012934
• WBVar00125315

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055524
• Remark: CBG17404, GGATGTGAAGGAACACTGAATAACTTCCACTCGCTCCAAAGATGTACAGAGATTTGCTGC, WBGene00037041
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region