WormMine: Gene WBGene00037055

• WormBase Gene ID: WBGene00037055
• Gene Name: Cbr-grd-1
• Sequence Name: CBG17433
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in protein autoprocessing. Is an ortholog of C. elegans grd-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17433.1	CBG17433.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17433	CBG17433		[unknown]

0 RNAi Result

28 Allele

• WBVar00041569
• WBVar00041564
• WBVar00041579
• WBVar00041574
• WBVar00041589
• WBVar00041584
• WBVar00041594
• WBVar00041599
• WBVar00041524
• WBVar00041529
• WBVar00041534
• WBVar00041539
• WBVar00041549
• WBVar00041544
• WBVar00041559
• WBVar00041554
• WBVar00041509
• WBVar00041514
• WBVar00041519
• WBVar00013179
• WBVar00013174
• WBVar00125360
• WBVar00125361
• WBVar00125359
• WBVar00125357
• WBVar00125358
• WBVar00023562
• WBVar00023567

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055205
• Remark: Cbr-grd-1, GCTTCCAACTGGAACGACGCTGTCAAAGGAGATCATGAGTCTGGTGCTACCCATCAGGAA, WBGene00037055
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region