WormMine: Gene WBGene00037061

• WormBase Gene ID: WBGene00037061
• Gene Name: Cbr-sulp-7
• Sequence Name: CBG17447
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans sulp-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17447.1	CBG17447.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17447	CBG17447		[unknown]

0 RNAi Result

21 Allele

• WBVar00138606
• WBVar00138608
• WBVar00138607
• WBVar00138609
• WBVar00138611
• WBVar00138610
• WBVar00138613
• WBVar00138612
• WBVar00138615
• WBVar00138614
• WBVar00138617
• WBVar00138616
• WBVar00138619
• WBVar00138618
• WBVar00041689
• WBVar00041684
• WBVar00041699
• WBVar00041694
• WBVar00041709
• WBVar00041704
• WBVar00125380

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050127
• Remark: Cbr-sulp-7, GCATTGTTATTGTCGCACTTCGAGGCATGTTTCTACATTTGACAAACTTTTGGACACTAT, WBGene00037061
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region