WormMine: Gene WBGene00037133

• WormBase Gene ID: WBGene00037133
• Gene Name: CBG17534
• Sequence Name: CBG17534
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein tyrosine kinase activity. Is an ortholog of C. elegans ver-1; ver-3; and ver-4. In C. elegans, ver-1 is involved in nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17534.1	CBG17534.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17534	CBG17534		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062065
• Remark: CBG17534, ACACGACTACCAGTTGCTATTAAAAGTACTAAGAGATCTTTCGACGTGGAGCTTCAGACA, WBGene00037133
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region